scrambled sirna nontarget control Search Results


90
Millennium Science millennium cat# d-001810-10-05
Millennium Cat# D 001810 10 05, supplied by Millennium Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/millennium cat# d-001810-10-05/product/Millennium Science
Average 90 stars, based on 1 article reviews
millennium cat# d-001810-10-05 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma scrambled control sirna
Scrambled Control Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scrambled control sirna/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
scrambled control sirna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma 6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas
6 Carboxyfluorescein Tagged, Negative Control (Nc) Scrambled Sirnas, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Genechem scrambled control shrna (5′-actatatatcgtccttaagct-3′)
Cells were pre-incubated with 100 μM 2-NBDG for 30 min. Flow cytometry histogram of 20,000 cells. A. Representative flow cytometry analysis of 2-NBDG glucose uptake following different treatments. B. Glucose uptake expressed as percent of control and mean changes in 2-NBDG fluorescence intensity (MFI). Significant differences vs . the TNF-α group are indicated, * p < 0.05. C. Membrane expression of Glut1 increased <t>after</t> <t>CD226</t> <t>shRNA</t> lentivirus infection with or without TNF-α treatment. Data are shown as the mean of three independent experiments.
Scrambled Control Shrna (5′ Actatatatcgtccttaagct 3′), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scrambled control shrna (5′-actatatatcgtccttaagct-3′)/product/Genechem
Average 90 stars, based on 1 article reviews
scrambled control shrna (5′-actatatatcgtccttaagct-3′) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Xeragon Inc fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg)
Cells were pre-incubated with 100 μM 2-NBDG for 30 min. Flow cytometry histogram of 20,000 cells. A. Representative flow cytometry analysis of 2-NBDG glucose uptake following different treatments. B. Glucose uptake expressed as percent of control and mean changes in 2-NBDG fluorescence intensity (MFI). Significant differences vs . the TNF-α group are indicated, * p < 0.05. C. Membrane expression of Glut1 increased <t>after</t> <t>CD226</t> <t>shRNA</t> lentivirus infection with or without TNF-α treatment. Data are shown as the mean of three independent experiments.
Fluorescence Labelled Control, Scrambled And Human P140cap Specific Sirnas (Aagctgtgtctgttgaggctg), supplied by Xeragon Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg)/product/Xeragon Inc
Average 90 stars, based on 1 article reviews
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Ribobio co sirna of arg2, ho-1, creb1 and their matched scramble control
Cells were pre-incubated with 100 μM 2-NBDG for 30 min. Flow cytometry histogram of 20,000 cells. A. Representative flow cytometry analysis of 2-NBDG glucose uptake following different treatments. B. Glucose uptake expressed as percent of control and mean changes in 2-NBDG fluorescence intensity (MFI). Significant differences vs . the TNF-α group are indicated, * p < 0.05. C. Membrane expression of Glut1 increased <t>after</t> <t>CD226</t> <t>shRNA</t> lentivirus infection with or without TNF-α treatment. Data are shown as the mean of three independent experiments.
Sirna Of Arg2, Ho 1, Creb1 And Their Matched Scramble Control, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna of arg2, ho-1, creb1 and their matched scramble control/product/Ribobio co
Average 90 stars, based on 1 article reviews
sirna of arg2, ho-1, creb1 and their matched scramble control - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Ribobio co scrambled control sirna
Cells were pre-incubated with 100 μM 2-NBDG for 30 min. Flow cytometry histogram of 20,000 cells. A. Representative flow cytometry analysis of 2-NBDG glucose uptake following different treatments. B. Glucose uptake expressed as percent of control and mean changes in 2-NBDG fluorescence intensity (MFI). Significant differences vs . the TNF-α group are indicated, * p < 0.05. C. Membrane expression of Glut1 increased <t>after</t> <t>CD226</t> <t>shRNA</t> lentivirus infection with or without TNF-α treatment. Data are shown as the mean of three independent experiments.
Scrambled Control Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scrambled control sirna/product/Ribobio co
Average 90 stars, based on 1 article reviews
scrambled control sirna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma stabletm sirna oligo nontargeting scrambled sirna
GPX4, CAT, and GSR regulate Nrf2 protein expression through ROS. (a and b) Representative FACS profile of ROS levels, which was measured by H2DCFDA staining, in GBC-SD (a) and QBC-939 (b) when GPX4, CAT, or GSR was overexpressed or knockdown. (c and d) Analysis of correlation between the protein level of Nrf2 and the mRNA level of GPX4 (c, left) or GSR (c, right) was performed in 36 GBC tissues, and the mRNA level of CAT (d, left) or GSR (d, right) was performed in 52 CC tissues. Spearman's correlation was used. (e and f) Immunoblot and qPCR analysis of Nrf2, and it target NQO1 from GBC-SD transfected with scrambled <t>siRNA</t> (si-Con) or siRNA (si- GPX4 and si- GSR ) and empty vector, GPX4 , or GSR (e), and from QBC-939 transfected with si-Con or siRNA (si- CAT and si- GSR ) and empty vector or CAT or GSR (F). n = 3; Bar, SEM. (g and i) qPCR analysis of NFE2L2, NQO1 and ABCG2 expression in GBC-SD (g: si-Con, si- GPX4 and si- GSR ), and in QBC-939 (i: si-Con, si- CAT and si- GSR ) cells cultured in standard media supplemented with or without 10 mM NAC. n = 3; Bar, SEM. (h and j) Immunoblots of Nrf2, NQO1 and ABCG2 protein in GBC-SD (h: si-Con, si- GPX4 and si- GSR ), and in QBC-939 (j: si-Con, si- CAT and si- GSR ) cells incubated with or without 10 mM NAC. * P < .05, ** P < .01, *** P < .001, Student's t- test.
Stabletm Sirna Oligo Nontargeting Scrambled Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stabletm sirna oligo nontargeting scrambled sirna/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
stabletm sirna oligo nontargeting scrambled sirna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Fasmac Co Ltd scramble control sirna uucuccgaacgugucacgutt
GPX4, CAT, and GSR regulate Nrf2 protein expression through ROS. (a and b) Representative FACS profile of ROS levels, which was measured by H2DCFDA staining, in GBC-SD (a) and QBC-939 (b) when GPX4, CAT, or GSR was overexpressed or knockdown. (c and d) Analysis of correlation between the protein level of Nrf2 and the mRNA level of GPX4 (c, left) or GSR (c, right) was performed in 36 GBC tissues, and the mRNA level of CAT (d, left) or GSR (d, right) was performed in 52 CC tissues. Spearman's correlation was used. (e and f) Immunoblot and qPCR analysis of Nrf2, and it target NQO1 from GBC-SD transfected with scrambled <t>siRNA</t> (si-Con) or siRNA (si- GPX4 and si- GSR ) and empty vector, GPX4 , or GSR (e), and from QBC-939 transfected with si-Con or siRNA (si- CAT and si- GSR ) and empty vector or CAT or GSR (F). n = 3; Bar, SEM. (g and i) qPCR analysis of NFE2L2, NQO1 and ABCG2 expression in GBC-SD (g: si-Con, si- GPX4 and si- GSR ), and in QBC-939 (i: si-Con, si- CAT and si- GSR ) cells cultured in standard media supplemented with or without 10 mM NAC. n = 3; Bar, SEM. (h and j) Immunoblots of Nrf2, NQO1 and ABCG2 protein in GBC-SD (h: si-Con, si- GPX4 and si- GSR ), and in QBC-939 (j: si-Con, si- CAT and si- GSR ) cells incubated with or without 10 mM NAC. * P < .05, ** P < .01, *** P < .001, Student's t- test.
Scramble Control Sirna Uucuccgaacgugucacgutt, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scramble control sirna uucuccgaacgugucacgutt/product/Fasmac Co Ltd
Average 90 stars, based on 1 article reviews
scramble control sirna uucuccgaacgugucacgutt - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma taqman her-2 rt-qpcr kits
GPX4, CAT, and GSR regulate Nrf2 protein expression through ROS. (a and b) Representative FACS profile of ROS levels, which was measured by H2DCFDA staining, in GBC-SD (a) and QBC-939 (b) when GPX4, CAT, or GSR was overexpressed or knockdown. (c and d) Analysis of correlation between the protein level of Nrf2 and the mRNA level of GPX4 (c, left) or GSR (c, right) was performed in 36 GBC tissues, and the mRNA level of CAT (d, left) or GSR (d, right) was performed in 52 CC tissues. Spearman's correlation was used. (e and f) Immunoblot and qPCR analysis of Nrf2, and it target NQO1 from GBC-SD transfected with scrambled <t>siRNA</t> (si-Con) or siRNA (si- GPX4 and si- GSR ) and empty vector, GPX4 , or GSR (e), and from QBC-939 transfected with si-Con or siRNA (si- CAT and si- GSR ) and empty vector or CAT or GSR (F). n = 3; Bar, SEM. (g and i) qPCR analysis of NFE2L2, NQO1 and ABCG2 expression in GBC-SD (g: si-Con, si- GPX4 and si- GSR ), and in QBC-939 (i: si-Con, si- CAT and si- GSR ) cells cultured in standard media supplemented with or without 10 mM NAC. n = 3; Bar, SEM. (h and j) Immunoblots of Nrf2, NQO1 and ABCG2 protein in GBC-SD (h: si-Con, si- GPX4 and si- GSR ), and in QBC-939 (j: si-Con, si- CAT and si- GSR ) cells incubated with or without 10 mM NAC. * P < .05, ** P < .01, *** P < .001, Student's t- test.
Taqman Her 2 Rt Qpcr Kits, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taqman her-2 rt-qpcr kits/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
taqman her-2 rt-qpcr kits - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Ribobio co small interfering (si)rnas targeting ncapg and a scrambled control sirna
<t>NCAPG-knockdown</t> decreases CDC25C expression and results in cell cycle arrest at the G 2 /M phase. (A) Effect of <t>siRNA-mediated</t> knockdown of NCAPG in the MCF-7 cell line. CDC25C (B) mRNA and (C) protein expression following knockdown of NCAPG in MCF-7 cells. Effects of (D) siRNA-NC, (E) siRNA-NCAPG1 and (F) siRNA-NCAPG2 on cell cycle distribution in MCF-7 cells. *P<0.05. NCAPG, non-SMC condensin I complex subunit G; CDC25C, cell division cyclin 25 homolog C; siRNA, small interfering RNA; NC, negative control.
Small Interfering (Si)Rnas Targeting Ncapg And A Scrambled Control Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/small interfering (si)rnas targeting ncapg and a scrambled control sirna/product/Ribobio co
Average 90 stars, based on 1 article reviews
small interfering (si)rnas targeting ncapg and a scrambled control sirna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma negative control of scrambled sirna not homologous to any gene
<t>NCAPG-knockdown</t> decreases CDC25C expression and results in cell cycle arrest at the G 2 /M phase. (A) Effect of <t>siRNA-mediated</t> knockdown of NCAPG in the MCF-7 cell line. CDC25C (B) mRNA and (C) protein expression following knockdown of NCAPG in MCF-7 cells. Effects of (D) siRNA-NC, (E) siRNA-NCAPG1 and (F) siRNA-NCAPG2 on cell cycle distribution in MCF-7 cells. *P<0.05. NCAPG, non-SMC condensin I complex subunit G; CDC25C, cell division cyclin 25 homolog C; siRNA, small interfering RNA; NC, negative control.
Negative Control Of Scrambled Sirna Not Homologous To Any Gene, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/negative control of scrambled sirna not homologous to any gene/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
negative control of scrambled sirna not homologous to any gene - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Cells were pre-incubated with 100 μM 2-NBDG for 30 min. Flow cytometry histogram of 20,000 cells. A. Representative flow cytometry analysis of 2-NBDG glucose uptake following different treatments. B. Glucose uptake expressed as percent of control and mean changes in 2-NBDG fluorescence intensity (MFI). Significant differences vs . the TNF-α group are indicated, * p < 0.05. C. Membrane expression of Glut1 increased after CD226 shRNA lentivirus infection with or without TNF-α treatment. Data are shown as the mean of three independent experiments.

Journal: Oncotarget

Article Title: CD226 reduces endothelial cell glucose uptake under hyperglycemic conditions with inflammation in type 2 diabetes mellitus

doi: 10.18632/oncotarget.7505

Figure Lengend Snippet: Cells were pre-incubated with 100 μM 2-NBDG for 30 min. Flow cytometry histogram of 20,000 cells. A. Representative flow cytometry analysis of 2-NBDG glucose uptake following different treatments. B. Glucose uptake expressed as percent of control and mean changes in 2-NBDG fluorescence intensity (MFI). Significant differences vs . the TNF-α group are indicated, * p < 0.05. C. Membrane expression of Glut1 increased after CD226 shRNA lentivirus infection with or without TNF-α treatment. Data are shown as the mean of three independent experiments.

Article Snippet: For CD226 knockdown, lentivirus encoding CD226 shRNA (5′-GCACTGTGTGAAGAGACATTG-3′) or scrambled control shRNA (5′-ACTATATATCGTCCTTAAGCT-3′) was purchased from Genechem (Shanghai, China).

Techniques: Incubation, Flow Cytometry, Fluorescence, Expressing, shRNA, Infection

HUVECs grown on chamber-slides after treatment were fixed and stained with FITC-phalloidin to detect F-actin as described in Materials and Methods. A. Control cells pretreated with scrambled control shRNA for 48 h and high glucose for another 12 h had few stress fibers. B. Following incubation with 10 ng/ml TNF-α and high glucose for another 12 h, F-actin was redistributed to the subcortical compartment and stress fibers formed. C. , D. Pretreatment with CD226 shRNA lentivirus for 48 h prevented redistribution of F-actin with or without TNF-α stimulation and 12 h of high glucose. Results are representative of three independent experiments.

Journal: Oncotarget

Article Title: CD226 reduces endothelial cell glucose uptake under hyperglycemic conditions with inflammation in type 2 diabetes mellitus

doi: 10.18632/oncotarget.7505

Figure Lengend Snippet: HUVECs grown on chamber-slides after treatment were fixed and stained with FITC-phalloidin to detect F-actin as described in Materials and Methods. A. Control cells pretreated with scrambled control shRNA for 48 h and high glucose for another 12 h had few stress fibers. B. Following incubation with 10 ng/ml TNF-α and high glucose for another 12 h, F-actin was redistributed to the subcortical compartment and stress fibers formed. C. , D. Pretreatment with CD226 shRNA lentivirus for 48 h prevented redistribution of F-actin with or without TNF-α stimulation and 12 h of high glucose. Results are representative of three independent experiments.

Article Snippet: For CD226 knockdown, lentivirus encoding CD226 shRNA (5′-GCACTGTGTGAAGAGACATTG-3′) or scrambled control shRNA (5′-ACTATATATCGTCCTTAAGCT-3′) was purchased from Genechem (Shanghai, China).

Techniques: Staining, shRNA, Incubation

GPX4, CAT, and GSR regulate Nrf2 protein expression through ROS. (a and b) Representative FACS profile of ROS levels, which was measured by H2DCFDA staining, in GBC-SD (a) and QBC-939 (b) when GPX4, CAT, or GSR was overexpressed or knockdown. (c and d) Analysis of correlation between the protein level of Nrf2 and the mRNA level of GPX4 (c, left) or GSR (c, right) was performed in 36 GBC tissues, and the mRNA level of CAT (d, left) or GSR (d, right) was performed in 52 CC tissues. Spearman's correlation was used. (e and f) Immunoblot and qPCR analysis of Nrf2, and it target NQO1 from GBC-SD transfected with scrambled siRNA (si-Con) or siRNA (si- GPX4 and si- GSR ) and empty vector, GPX4 , or GSR (e), and from QBC-939 transfected with si-Con or siRNA (si- CAT and si- GSR ) and empty vector or CAT or GSR (F). n = 3; Bar, SEM. (g and i) qPCR analysis of NFE2L2, NQO1 and ABCG2 expression in GBC-SD (g: si-Con, si- GPX4 and si- GSR ), and in QBC-939 (i: si-Con, si- CAT and si- GSR ) cells cultured in standard media supplemented with or without 10 mM NAC. n = 3; Bar, SEM. (h and j) Immunoblots of Nrf2, NQO1 and ABCG2 protein in GBC-SD (h: si-Con, si- GPX4 and si- GSR ), and in QBC-939 (j: si-Con, si- CAT and si- GSR ) cells incubated with or without 10 mM NAC. * P < .05, ** P < .01, *** P < .001, Student's t- test.

Journal: EBioMedicine

Article Title: Variants in oxidative stress-related genes affect the chemosensitivity through Nrf2-mediated signaling pathway in biliary tract cancer

doi: 10.1016/j.ebiom.2019.08.037

Figure Lengend Snippet: GPX4, CAT, and GSR regulate Nrf2 protein expression through ROS. (a and b) Representative FACS profile of ROS levels, which was measured by H2DCFDA staining, in GBC-SD (a) and QBC-939 (b) when GPX4, CAT, or GSR was overexpressed or knockdown. (c and d) Analysis of correlation between the protein level of Nrf2 and the mRNA level of GPX4 (c, left) or GSR (c, right) was performed in 36 GBC tissues, and the mRNA level of CAT (d, left) or GSR (d, right) was performed in 52 CC tissues. Spearman's correlation was used. (e and f) Immunoblot and qPCR analysis of Nrf2, and it target NQO1 from GBC-SD transfected with scrambled siRNA (si-Con) or siRNA (si- GPX4 and si- GSR ) and empty vector, GPX4 , or GSR (e), and from QBC-939 transfected with si-Con or siRNA (si- CAT and si- GSR ) and empty vector or CAT or GSR (F). n = 3; Bar, SEM. (g and i) qPCR analysis of NFE2L2, NQO1 and ABCG2 expression in GBC-SD (g: si-Con, si- GPX4 and si- GSR ), and in QBC-939 (i: si-Con, si- CAT and si- GSR ) cells cultured in standard media supplemented with or without 10 mM NAC. n = 3; Bar, SEM. (h and j) Immunoblots of Nrf2, NQO1 and ABCG2 protein in GBC-SD (h: si-Con, si- GPX4 and si- GSR ), and in QBC-939 (j: si-Con, si- CAT and si- GSR ) cells incubated with or without 10 mM NAC. * P < .05, ** P < .01, *** P < .001, Student's t- test.

Article Snippet: The following StableTM siRNA oligo (Genepharma, Shanghai, China) were used: nontargeting scrambled siRNA, human GPX4 siRNA, human CAT siRNA, human GSR siRNA, and human ABCG2 siRNA.

Techniques: Expressing, Staining, Knockdown, Western Blot, Transfection, Plasmid Preparation, Cell Culture, Incubation

GPX4, CAT, and GSR regulate chemosensitivity through Nrf2-mediated ABCG2 expression. (a and b) qPCR analysis of ABCG2 and NQO1 mRNA expression in paired GBC-SD (a) and QBC-939 (b) cells transfected with or without siRNA of GPX4, GSR, CAT . n = 3; Bar, SEM. (c and d) Immunoblots of ABCG2 and NQO1 in paired GBC-SD (c) and QBC-939 (d) cells that expressed GPX4, GSR , or CAT targeting siRNAs or a scrambled siRNA. (e and f) ABCG2-promoter luciferase assay in paired GBC-SD (a) and QBC-939 (b) cells that were transfected with or without siRNA of GPX4, GSR, CAT . n = 3; Bar, SEM. (g) The canonical sequence of the Nrf2-binding site (top, red), a potential Nrf2-binding site at -431 bp to -420 bp in the proximal promoter region of the human ABCG2 gene (middle, red), and introduced point mutations (bottom, green) used to inactivate the potential ABCG2-binding site are shown. (h and i) Determination of luciferase activity using vector only, wild type or mutant ABCG2 promoter in different pairs of GBC-SD (h) and QBC-939 (i) cells. (j) ChIP analysis of paired GBC-SD (sh-Con and sh- NFE2L2 ) cells immunoprecipitated by anti-Nrf2 or IgG antibody followed by qPCR using 2 primer sets for the Nrf2-binding site in the ABCG2 promoter or ABCG2 exon 1, respectively. Data represent the percent of input. n = 3; Bar, SEM. (k) Doxorubicin efflux of paired GBC-SD (left) and QBC-939 (right) cells were detected by FACS. * P < .05, ** P < .01, *** P < .001, Student's t- test. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Journal: EBioMedicine

Article Title: Variants in oxidative stress-related genes affect the chemosensitivity through Nrf2-mediated signaling pathway in biliary tract cancer

doi: 10.1016/j.ebiom.2019.08.037

Figure Lengend Snippet: GPX4, CAT, and GSR regulate chemosensitivity through Nrf2-mediated ABCG2 expression. (a and b) qPCR analysis of ABCG2 and NQO1 mRNA expression in paired GBC-SD (a) and QBC-939 (b) cells transfected with or without siRNA of GPX4, GSR, CAT . n = 3; Bar, SEM. (c and d) Immunoblots of ABCG2 and NQO1 in paired GBC-SD (c) and QBC-939 (d) cells that expressed GPX4, GSR , or CAT targeting siRNAs or a scrambled siRNA. (e and f) ABCG2-promoter luciferase assay in paired GBC-SD (a) and QBC-939 (b) cells that were transfected with or without siRNA of GPX4, GSR, CAT . n = 3; Bar, SEM. (g) The canonical sequence of the Nrf2-binding site (top, red), a potential Nrf2-binding site at -431 bp to -420 bp in the proximal promoter region of the human ABCG2 gene (middle, red), and introduced point mutations (bottom, green) used to inactivate the potential ABCG2-binding site are shown. (h and i) Determination of luciferase activity using vector only, wild type or mutant ABCG2 promoter in different pairs of GBC-SD (h) and QBC-939 (i) cells. (j) ChIP analysis of paired GBC-SD (sh-Con and sh- NFE2L2 ) cells immunoprecipitated by anti-Nrf2 or IgG antibody followed by qPCR using 2 primer sets for the Nrf2-binding site in the ABCG2 promoter or ABCG2 exon 1, respectively. Data represent the percent of input. n = 3; Bar, SEM. (k) Doxorubicin efflux of paired GBC-SD (left) and QBC-939 (right) cells were detected by FACS. * P < .05, ** P < .01, *** P < .001, Student's t- test. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: The following StableTM siRNA oligo (Genepharma, Shanghai, China) were used: nontargeting scrambled siRNA, human GPX4 siRNA, human CAT siRNA, human GSR siRNA, and human ABCG2 siRNA.

Techniques: Expressing, Transfection, Western Blot, Luciferase, Sequencing, Binding Assay, Activity Assay, Plasmid Preparation, Mutagenesis, Immunoprecipitation

Nrf2 is the key element for growth and chemoresistance of BTC xenografts. (a and c) GBC-SD or QBC-939 cells stably expressing NFE2L2 -targeting shRNA (sh- NFE2L2 ) or scrambled shRNA (sh-Con) were injected into the flank of athymic nude mice s.c. ( n = 6 mice for each group) to create tumor xenografts. After tumors were about 5 mm in diameter, the first paired mice group was treated with saline, the second was treated with cisplatin (6 mg/kg), and the third was combined radical surgery and cisplatin (6 mg/kg) treatment. The chemotherapy was given once every nine days for 1 month. Tumor growth was determined by measurement of tumor volume, tumor weight, and the frequency of tumor formation. Tumor growth curves (left), tumor weigh (middle), and tumor-free percentages (right) at the indicated times were plotted. n = 6; Bar, SEM. (b and d) H&E, TUNEL, and IHC analysis of Ki-67, Nrf2, and ABCG2 expressions in tumor (b: GBC-SD; d: QBC-939) xenografts of the second paired mice groups. Representative images from 6 separate samples are shown. Original magnification, × 400; scale bars: 50 μm. * P < .05, ** P < .01, *** P < .001, Student's t- test.

Journal: EBioMedicine

Article Title: Variants in oxidative stress-related genes affect the chemosensitivity through Nrf2-mediated signaling pathway in biliary tract cancer

doi: 10.1016/j.ebiom.2019.08.037

Figure Lengend Snippet: Nrf2 is the key element for growth and chemoresistance of BTC xenografts. (a and c) GBC-SD or QBC-939 cells stably expressing NFE2L2 -targeting shRNA (sh- NFE2L2 ) or scrambled shRNA (sh-Con) were injected into the flank of athymic nude mice s.c. ( n = 6 mice for each group) to create tumor xenografts. After tumors were about 5 mm in diameter, the first paired mice group was treated with saline, the second was treated with cisplatin (6 mg/kg), and the third was combined radical surgery and cisplatin (6 mg/kg) treatment. The chemotherapy was given once every nine days for 1 month. Tumor growth was determined by measurement of tumor volume, tumor weight, and the frequency of tumor formation. Tumor growth curves (left), tumor weigh (middle), and tumor-free percentages (right) at the indicated times were plotted. n = 6; Bar, SEM. (b and d) H&E, TUNEL, and IHC analysis of Ki-67, Nrf2, and ABCG2 expressions in tumor (b: GBC-SD; d: QBC-939) xenografts of the second paired mice groups. Representative images from 6 separate samples are shown. Original magnification, × 400; scale bars: 50 μm. * P < .05, ** P < .01, *** P < .001, Student's t- test.

Article Snippet: The following StableTM siRNA oligo (Genepharma, Shanghai, China) were used: nontargeting scrambled siRNA, human GPX4 siRNA, human CAT siRNA, human GSR siRNA, and human ABCG2 siRNA.

Techniques: Stable Transfection, Expressing, shRNA, Injection, Saline, TUNEL Assay

NCAPG-knockdown decreases CDC25C expression and results in cell cycle arrest at the G 2 /M phase. (A) Effect of siRNA-mediated knockdown of NCAPG in the MCF-7 cell line. CDC25C (B) mRNA and (C) protein expression following knockdown of NCAPG in MCF-7 cells. Effects of (D) siRNA-NC, (E) siRNA-NCAPG1 and (F) siRNA-NCAPG2 on cell cycle distribution in MCF-7 cells. *P<0.05. NCAPG, non-SMC condensin I complex subunit G; CDC25C, cell division cyclin 25 homolog C; siRNA, small interfering RNA; NC, negative control.

Journal: Oncology Letters

Article Title: NCAPG upregulation mediated by four microRNAs combined with activation of the p53 signaling pathway is a predictor of poor prognosis in patients with breast cancer

doi: 10.3892/ol.2021.12585

Figure Lengend Snippet: NCAPG-knockdown decreases CDC25C expression and results in cell cycle arrest at the G 2 /M phase. (A) Effect of siRNA-mediated knockdown of NCAPG in the MCF-7 cell line. CDC25C (B) mRNA and (C) protein expression following knockdown of NCAPG in MCF-7 cells. Effects of (D) siRNA-NC, (E) siRNA-NCAPG1 and (F) siRNA-NCAPG2 on cell cycle distribution in MCF-7 cells. *P<0.05. NCAPG, non-SMC condensin I complex subunit G; CDC25C, cell division cyclin 25 homolog C; siRNA, small interfering RNA; NC, negative control.

Article Snippet: Small interfering (si)RNAs targeting NCAPG and a scrambled control siRNA used as the negative control (NC) were purchased from Guangzhou RiboBio Co., Ltd. NCAPG siRNAs and the NC (50 nM) were transfected using Lipofectamine ® 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) into cells, according to the manufacturer's protocol.

Techniques: Knockdown, Expressing, Small Interfering RNA, Negative Control